ID: 1203774648

View in Genome Browser
Species Human (GRCh38)
Location EBV:65963-65985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774641_1203774648 25 Left 1203774641 EBV:65915-65937 CCAGGTGACGGGCTGTTCGGACG No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774642_1203774648 2 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774640_1203774648 26 Left 1203774640 EBV:65914-65936 CCCAGGTGACGGGCTGTTCGGAC No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774643_1203774648 -5 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774644_1203774648 -6 Left 1203774644 EBV:65946-65968 CCCTTCTATGCCAATGCGTCCAC No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774645_1203774648 -7 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774648 Original CRISPR GTCCACCAAGGTCACCAACA AGG Intergenic