ID: 1203774654

View in Genome Browser
Species Human (GRCh38)
Location EBV:65977-65999
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774647_1203774654 -2 Left 1203774647 EBV:65956-65978 CCAATGCGTCCACCAAGGTCACC No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774643_1203774654 9 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774642_1203774654 16 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774645_1203774654 7 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774644_1203774654 8 Left 1203774644 EBV:65946-65968 CCCTTCTATGCCAATGCGTCCAC No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774654 Original CRISPR CCAACAAGGAGGAGGCCCTT AGG Intergenic
No off target data available for this crispr