ID: 1203774655

View in Genome Browser
Species Human (GRCh38)
Location EBV:65986-66008
Sequence AGGAGGCCCTTAGGCCAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774647_1203774655 7 Left 1203774647 EBV:65956-65978 CCAATGCGTCCACCAAGGTCACC No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774644_1203774655 17 Left 1203774644 EBV:65946-65968 CCCTTCTATGCCAATGCGTCCAC No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774645_1203774655 16 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774643_1203774655 18 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774649_1203774655 -2 Left 1203774649 EBV:65965-65987 CCACCAAGGTCACCAACAAGGAG No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774651_1203774655 -5 Left 1203774651 EBV:65968-65990 CCAAGGTCACCAACAAGGAGGAG No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774642_1203774655 25 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774655 Original CRISPR AGGAGGCCCTTAGGCCAAAC CGG Intergenic
No off target data available for this crispr