ID: 1203774658

View in Genome Browser
Species Human (GRCh38)
Location EBV:65995-66017
Sequence TTAGGCCAAACCGGTCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774653_1203774658 -5 Left 1203774653 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774649_1203774658 7 Left 1203774649 EBV:65965-65987 CCACCAAGGTCACCAACAAGGAG No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774643_1203774658 27 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774645_1203774658 25 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774644_1203774658 26 Left 1203774644 EBV:65946-65968 CCCTTCTATGCCAATGCGTCCAC No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774651_1203774658 4 Left 1203774651 EBV:65968-65990 CCAAGGTCACCAACAAGGAGGAG No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774647_1203774658 16 Left 1203774647 EBV:65956-65978 CCAATGCGTCCACCAAGGTCACC No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774658 Original CRISPR TTAGGCCAAACCGGTCTTTT TGG Intergenic
No off target data available for this crispr