ID: 1203774836

View in Genome Browser
Species Human (GRCh38)
Location EBV:67096-67118
Sequence TCTACAGCATAGCCCTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774834_1203774836 12 Left 1203774834 EBV:67061-67083 CCTGCTGATTGAAGGCATCTTCT No data
Right 1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774836 Original CRISPR TCTACAGCATAGCCCTGCTG CGG Intergenic
No off target data available for this crispr