ID: 1203775289

View in Genome Browser
Species Human (GRCh38)
Location EBV:69573-69595
Sequence CCCCACAGAGAAAGAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203775289_1203775298 -7 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775298 EBV:69589-69611 TGTGGGGCGATGGCCTCCGGGGG No data
1203775289_1203775300 4 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775300 EBV:69600-69622 GGCCTCCGGGGGGCTGTACCTGG No data
1203775289_1203775301 5 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data
1203775289_1203775297 -8 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775297 EBV:69588-69610 CTGTGGGGCGATGGCCTCCGGGG No data
1203775289_1203775295 -10 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775295 EBV:69586-69608 CTCTGTGGGGCGATGGCCTCCGG No data
1203775289_1203775299 -6 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775299 EBV:69590-69612 GTGGGGCGATGGCCTCCGGGGGG No data
1203775289_1203775296 -9 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775296 EBV:69587-69609 TCTGTGGGGCGATGGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203775289 Original CRISPR CCCCACAGAGAAAGAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr