ID: 1203775291

View in Genome Browser
Species Human (GRCh38)
Location EBV:69577-69599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203775291_1203775307 30 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data
1203775291_1203775299 -10 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775299 EBV:69590-69612 GTGGGGCGATGGCCTCCGGGGGG No data
1203775291_1203775300 0 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775300 EBV:69600-69622 GGCCTCCGGGGGGCTGTACCTGG No data
1203775291_1203775301 1 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203775291 Original CRISPR ATCGCCCCACAGAGAAAGAG GGG (reversed) Intergenic
No off target data available for this crispr