ID: 1203775301

View in Genome Browser
Species Human (GRCh38)
Location EBV:69601-69623
Sequence GCCTCCGGGGGGCTGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203775289_1203775301 5 Left 1203775289 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data
1203775292_1203775301 0 Left 1203775292 EBV:69578-69600 CCCTCTTTCTCTGTGGGGCGATG No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data
1203775291_1203775301 1 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data
1203775293_1203775301 -1 Left 1203775293 EBV:69579-69601 CCTCTTTCTCTGTGGGGCGATGG No data
Right 1203775301 EBV:69601-69623 GCCTCCGGGGGGCTGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203775301 Original CRISPR GCCTCCGGGGGGCTGTACCT GGG Intergenic
No off target data available for this crispr