ID: 1203775307

View in Genome Browser
Species Human (GRCh38)
Location EBV:69630-69652
Sequence CAGCATCATTGCATGTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203775293_1203775307 28 Left 1203775293 EBV:69579-69601 CCTCTTTCTCTGTGGGGCGATGG No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data
1203775303_1203775307 2 Left 1203775303 EBV:69605-69627 CCGGGGGGCTGTACCTGGGCCAT No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data
1203775291_1203775307 30 Left 1203775291 EBV:69577-69599 CCCCTCTTTCTCTGTGGGGCGAT No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data
1203775302_1203775307 5 Left 1203775302 EBV:69602-69624 CCTCCGGGGGGCTGTACCTGGGC No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data
1203775292_1203775307 29 Left 1203775292 EBV:69578-69600 CCCTCTTTCTCTGTGGGGCGATG No data
Right 1203775307 EBV:69630-69652 CAGCATCATTGCATGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203775307 Original CRISPR CAGCATCATTGCATGTGTCA TGG Intergenic
No off target data available for this crispr