ID: 1203779047

View in Genome Browser
Species Human (GRCh38)
Location EBV:90652-90674
Sequence ATGTTTCAACCGCTCCGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203779047_1203779055 23 Left 1203779047 EBV:90652-90674 CCCAGTCGGAGCGGTTGAAACAT No data
Right 1203779055 EBV:90698-90720 GGCAGAGGCTCTGGCAGCACCGG No data
1203779047_1203779050 -6 Left 1203779047 EBV:90652-90674 CCCAGTCGGAGCGGTTGAAACAT No data
Right 1203779050 EBV:90669-90691 AAACATGATAGGCAGTTAGCTGG No data
1203779047_1203779051 2 Left 1203779047 EBV:90652-90674 CCCAGTCGGAGCGGTTGAAACAT No data
Right 1203779051 EBV:90677-90699 TAGGCAGTTAGCTGGCCTTGTGG No data
1203779047_1203779052 8 Left 1203779047 EBV:90652-90674 CCCAGTCGGAGCGGTTGAAACAT No data
Right 1203779052 EBV:90683-90705 GTTAGCTGGCCTTGTGGCAGAGG No data
1203779047_1203779053 14 Left 1203779047 EBV:90652-90674 CCCAGTCGGAGCGGTTGAAACAT No data
Right 1203779053 EBV:90689-90711 TGGCCTTGTGGCAGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203779047 Original CRISPR ATGTTTCAACCGCTCCGACT GGG (reversed) Intergenic
No off target data available for this crispr