ID: 1203781098

View in Genome Browser
Species Human (GRCh38)
Location EBV:101257-101279
Sequence TGCAGGGAATGCGGCCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203781094_1203781098 -10 Left 1203781094 EBV:101244-101266 CCCACGCAGACGATGCAGGGAAT No data
Right 1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203781098 Original CRISPR TGCAGGGAATGCGGCCCCGG CGG Intergenic
No off target data available for this crispr