ID: 1203781520

View in Genome Browser
Species Human (GRCh38)
Location EBV:103677-103699
Sequence TCCGTGTCCCCCCGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203781520_1203781527 28 Left 1203781520 EBV:103677-103699 CCATCAGCCCGGGGGGACACGGA No data
Right 1203781527 EBV:103728-103750 CGTGACCCCCCGCCTGGTGCTGG No data
1203781520_1203781526 22 Left 1203781520 EBV:103677-103699 CCATCAGCCCGGGGGGACACGGA No data
Right 1203781526 EBV:103722-103744 CCTGCGCGTGACCCCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203781520 Original CRISPR TCCGTGTCCCCCCGGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr