ID: 1203781763

View in Genome Browser
Species Human (GRCh38)
Location EBV:104901-104923
Sequence ACTCGGGGCCCTTTTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203781763_1203781773 19 Left 1203781763 EBV:104901-104923 CCAAACCAAAAAGGGCCCCGAGT No data
Right 1203781773 EBV:104943-104965 GTAAAGATCCCCCTGAAAGATGG No data
1203781763_1203781778 30 Left 1203781763 EBV:104901-104923 CCAAACCAAAAAGGGCCCCGAGT No data
Right 1203781778 EBV:104954-104976 CCTGAAAGATGGCCATCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203781763 Original CRISPR ACTCGGGGCCCTTTTTGGTT TGG (reversed) Intergenic
No off target data available for this crispr