ID: 1203783212

View in Genome Browser
Species Human (GRCh38)
Location EBV:112633-112655
Sequence CAGCATGTTCAACGCGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203783212_1203783214 -6 Left 1203783212 EBV:112633-112655 CCTTGACCGCGTTGAACATGCTG No data
Right 1203783214 EBV:112650-112672 ATGCTGTATGCCTCGCAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203783212 Original CRISPR CAGCATGTTCAACGCGGTCA AGG (reversed) Intergenic
No off target data available for this crispr