ID: 1203783370

View in Genome Browser
Species Human (GRCh38)
Location EBV:113762-113784
Sequence GAGGATGCCCCCTTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203783370_1203783378 21 Left 1203783370 EBV:113762-113784 CCCACCACAAAGGGGGCATCCTC No data
Right 1203783378 EBV:113806-113828 CAAAGCCCGATGCCCAGTTATGG No data
1203783370_1203783379 22 Left 1203783370 EBV:113762-113784 CCCACCACAAAGGGGGCATCCTC No data
Right 1203783379 EBV:113807-113829 AAAGCCCGATGCCCAGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203783370 Original CRISPR GAGGATGCCCCCTTTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr