ID: 1203783384

View in Genome Browser
Species Human (GRCh38)
Location EBV:113826-113848
Sequence TGGGTACGTAGTCGTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203783375_1203783384 19 Left 1203783375 EBV:113784-113806 CCGGTTTGAACATCAGACCCAAC No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data
1203783376_1203783384 2 Left 1203783376 EBV:113801-113823 CCCAACAAAGCCCGATGCCCAGT No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data
1203783377_1203783384 1 Left 1203783377 EBV:113802-113824 CCAACAAAGCCCGATGCCCAGTT No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data
1203783374_1203783384 22 Left 1203783374 EBV:113781-113803 CCTCCGGTTTGAACATCAGACCC No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data
1203783381_1203783384 -9 Left 1203783381 EBV:113812-113834 CCGATGCCCAGTTATGGGTACGT No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data
1203783380_1203783384 -8 Left 1203783380 EBV:113811-113833 CCCGATGCCCAGTTATGGGTACG No data
Right 1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203783384 Original CRISPR TGGGTACGTAGTCGTTGTTC AGG Intergenic