ID: 1203785799

View in Genome Browser
Species Human (GRCh38)
Location EBV:126798-126820
Sequence TTCCCTCGGTGGTGTCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203785795_1203785799 6 Left 1203785795 EBV:126769-126791 CCGAAGCGGGGTCTTTTGGACTA No data
Right 1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG No data
1203785790_1203785799 21 Left 1203785790 EBV:126754-126776 CCTAGTCAGAGAGAACCGAAGCG No data
Right 1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203785799 Original CRISPR TTCCCTCGGTGGTGTCCTGC CGG Intergenic
No off target data available for this crispr