ID: 1203786659

View in Genome Browser
Species Human (GRCh38)
Location EBV:132130-132152
Sequence CGGAACCAGGAGAAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203786650_1203786659 20 Left 1203786650 EBV:132087-132109 CCGGCTCGTGGAGTCCGCACCTC No data
Right 1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG No data
1203786651_1203786659 6 Left 1203786651 EBV:132101-132123 CCGCACCTCCTTCTGTGCACGAA No data
Right 1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG No data
1203786653_1203786659 -2 Left 1203786653 EBV:132109-132131 CCTTCTGTGCACGAAGTTTTGCG No data
Right 1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG No data
1203786652_1203786659 1 Left 1203786652 EBV:132106-132128 CCTCCTTCTGTGCACGAAGTTTT No data
Right 1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203786659 Original CRISPR CGGAACCAGGAGAAGGGGTC TGG Intergenic
No off target data available for this crispr