ID: 1203791147

View in Genome Browser
Species Human (GRCh38)
Location EBV:152281-152303
Sequence GACTCACTTGGGTATGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203791147_1203791155 17 Left 1203791147 EBV:152281-152303 CCAACGCCATACCCAAGTGAGTC No data
Right 1203791155 EBV:152321-152343 GCCCAAGAACATCATGTTCTGGG No data
1203791147_1203791152 -5 Left 1203791147 EBV:152281-152303 CCAACGCCATACCCAAGTGAGTC No data
Right 1203791152 EBV:152299-152321 GAGTCCATACGGAGCACATCAGG No data
1203791147_1203791158 25 Left 1203791147 EBV:152281-152303 CCAACGCCATACCCAAGTGAGTC No data
Right 1203791158 EBV:152329-152351 ACATCATGTTCTGGGTCAAAAGG No data
1203791147_1203791154 16 Left 1203791147 EBV:152281-152303 CCAACGCCATACCCAAGTGAGTC No data
Right 1203791154 EBV:152320-152342 GGCCCAAGAACATCATGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203791147 Original CRISPR GACTCACTTGGGTATGGCGT TGG (reversed) Intergenic
No off target data available for this crispr