ID: 1203791688

View in Genome Browser
Species Human (GRCh38)
Location EBV:155022-155044
Sequence GCGACCCCATGATGCGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203791688_1203791697 20 Left 1203791688 EBV:155022-155044 CCTTGCCCGCATCATGGGGTCGC No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791688_1203791701 25 Left 1203791688 EBV:155022-155044 CCTTGCCCGCATCATGGGGTCGC No data
Right 1203791701 EBV:155070-155092 TAATTTTGCCCAGAGAGGCTGGG No data
1203791688_1203791700 24 Left 1203791688 EBV:155022-155044 CCTTGCCCGCATCATGGGGTCGC No data
Right 1203791700 EBV:155069-155091 CTAATTTTGCCCAGAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203791688 Original CRISPR GCGACCCCATGATGCGGGCA AGG (reversed) Intergenic
No off target data available for this crispr