ID: 1203791691

View in Genome Browser
Species Human (GRCh38)
Location EBV:155044-155066
Sequence CTGGGGGCGTCTGCGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203791691_1203791704 25 Left 1203791691 EBV:155044-155066 CCTGACCTCGCAGACGCCCCCAG No data
Right 1203791704 EBV:155092-155114 GTTGATGCTGTAGATGTGCCTGG No data
1203791691_1203791697 -2 Left 1203791691 EBV:155044-155066 CCTGACCTCGCAGACGCCCCCAG No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791691_1203791701 3 Left 1203791691 EBV:155044-155066 CCTGACCTCGCAGACGCCCCCAG No data
Right 1203791701 EBV:155070-155092 TAATTTTGCCCAGAGAGGCTGGG No data
1203791691_1203791700 2 Left 1203791691 EBV:155044-155066 CCTGACCTCGCAGACGCCCCCAG No data
Right 1203791700 EBV:155069-155091 CTAATTTTGCCCAGAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203791691 Original CRISPR CTGGGGGCGTCTGCGAGGTC AGG (reversed) Intergenic
No off target data available for this crispr