ID: 1203791697

View in Genome Browser
Species Human (GRCh38)
Location EBV:155065-155087
Sequence AGCCCTAATTTTGCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203791688_1203791697 20 Left 1203791688 EBV:155022-155044 CCTTGCCCGCATCATGGGGTCGC No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791689_1203791697 15 Left 1203791689 EBV:155027-155049 CCCGCATCATGGGGTCGCCTGAC No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791687_1203791697 21 Left 1203791687 EBV:155021-155043 CCCTTGCCCGCATCATGGGGTCG No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791690_1203791697 14 Left 1203791690 EBV:155028-155050 CCGCATCATGGGGTCGCCTGACC No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791691_1203791697 -2 Left 1203791691 EBV:155044-155066 CCTGACCTCGCAGACGCCCCCAG No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data
1203791692_1203791697 -7 Left 1203791692 EBV:155049-155071 CCTCGCAGACGCCCCCAGCCCTA No data
Right 1203791697 EBV:155065-155087 AGCCCTAATTTTGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203791697 Original CRISPR AGCCCTAATTTTGCCCAGAG AGG Intergenic
No off target data available for this crispr