ID: 1203793730

View in Genome Browser
Species Human (GRCh38)
Location EBV:165072-165094
Sequence CGGCCACACAGGAGGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203793730_1203793739 5 Left 1203793730 EBV:165072-165094 CCTGTTGGCCTCCTGTGTGGCCG No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data
1203793730_1203793738 4 Left 1203793730 EBV:165072-165094 CCTGTTGGCCTCCTGTGTGGCCG No data
Right 1203793738 EBV:165099-165121 CCAGGCTGTCACCGCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203793730 Original CRISPR CGGCCACACAGGAGGCCAAC AGG (reversed) Intergenic
No off target data available for this crispr