ID: 1203793739

View in Genome Browser
Species Human (GRCh38)
Location EBV:165100-165122
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203793726_1203793739 27 Left 1203793726 EBV:165050-165072 CCAGGTTCATCGCTCAGCTCCTC No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data
1203793734_1203793739 -6 Left 1203793734 EBV:165083-165105 CCTGTGTGGCCGCCGGCCAGGCT No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data
1203793728_1203793739 8 Left 1203793728 EBV:165069-165091 CCTCCTGTTGGCCTCCTGTGTGG No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data
1203793730_1203793739 5 Left 1203793730 EBV:165072-165094 CCTGTTGGCCTCCTGTGTGGCCG No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data
1203793732_1203793739 -3 Left 1203793732 EBV:165080-165102 CCTCCTGTGTGGCCGCCGGCCAG No data
Right 1203793739 EBV:165100-165122 CAGGCTGTCACCGCTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203793739 Original CRISPR CAGGCTGTCACCGCTTTCTT GGG Intergenic
No off target data available for this crispr