ID: 900002340

View in Genome Browser
Species Human (GRCh38)
Location 1:21606-21628
Sequence TTGTGTCCCCACGGTGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900002340_900002354 30 Left 900002340 1:21606-21628 CCCGTGGCACCGTGGGGACACAA No data
Right 900002354 1:21659-21681 TTCAAAGAGGCCTGGCCCACAGG No data
900002340_900002350 22 Left 900002340 1:21606-21628 CCCGTGGCACCGTGGGGACACAA No data
Right 900002350 1:21651-21673 CAGCCCCATTCAAAGAGGCCTGG No data
900002340_900002347 17 Left 900002340 1:21606-21628 CCCGTGGCACCGTGGGGACACAA No data
Right 900002347 1:21646-21668 TCCCTCAGCCCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900002340 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG (reversed) Intergenic
No off target data available for this crispr