ID: 900003980

View in Genome Browser
Species Human (GRCh38)
Location 1:32077-32099
Sequence CCCAGCTGGCCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900003980_900003988 0 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003988 1:32100-32122 CTGAGCGGGCCTGGGAATTAAGG No data
900003980_900003989 7 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003989 1:32107-32129 GGCCTGGGAATTAAGGCTGCAGG No data
900003980_900003986 -9 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003986 1:32091-32113 CCAGCTGGGCTGAGCGGGCCTGG No data
900003980_900003987 -8 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003987 1:32092-32114 CAGCTGGGCTGAGCGGGCCTGGG No data
900003980_900003993 19 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG No data
900003980_900003990 8 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003990 1:32108-32130 GCCTGGGAATTAAGGCTGCAGGG No data
900003980_900003992 12 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003992 1:32112-32134 GGGAATTAAGGCTGCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900003980 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr