ID: 900003993

View in Genome Browser
Species Human (GRCh38)
Location 1:32119-32141
Sequence AAGGCTGCAGGGTTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900003980_900003993 19 Left 900003980 1:32077-32099 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG No data
900003985_900003993 5 Left 900003985 1:32091-32113 CCAGCTGGGCTGAGCGGGCCTGG No data
Right 900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG No data
900003982_900003993 15 Left 900003982 1:32081-32103 CCTTTGCTGGCCAGCTGGGCTGA No data
Right 900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900003993 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG Intergenic
No off target data available for this crispr