ID: 900004820

View in Genome Browser
Species Human (GRCh38)
Location 1:37961-37983
Sequence TAGCCAGGAGTCTCATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900004810_900004820 19 Left 900004810 1:37919-37941 CCAGGTCCTGAGTAAAGTTGAAG No data
Right 900004820 1:37961-37983 TAGCCAGGAGTCTCATCCCCTGG No data
900004814_900004820 13 Left 900004814 1:37925-37947 CCTGAGTAAAGTTGAAGGGGAGG No data
Right 900004820 1:37961-37983 TAGCCAGGAGTCTCATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900004820 Original CRISPR TAGCCAGGAGTCTCATCCCC TGG Intergenic
No off target data available for this crispr