ID: 900020158

View in Genome Browser
Species Human (GRCh38)
Location 1:182606-182628
Sequence AGCCATGCCTAGAGTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900020149_900020158 23 Left 900020149 1:182560-182582 CCAGGGTGCAAGCTGAGCACTGG No data
Right 900020158 1:182606-182628 AGCCATGCCTAGAGTGGGATGGG No data
900020148_900020158 29 Left 900020148 1:182554-182576 CCTGTGCCAGGGTGCAAGCTGAG No data
Right 900020158 1:182606-182628 AGCCATGCCTAGAGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900020158 Original CRISPR AGCCATGCCTAGAGTGGGAT GGG Intergenic
No off target data available for this crispr