ID: 900022059

View in Genome Browser
Species Human (GRCh38)
Location 1:192130-192152
Sequence TTGTGTCCCCACGGTGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900022059_900022069 22 Left 900022059 1:192130-192152 CCCGTGGCACCGTGGGGACACAA No data
Right 900022069 1:192175-192197 CAGCCCCATTCAAAGAGGCCTGG No data
900022059_900022066 17 Left 900022059 1:192130-192152 CCCGTGGCACCGTGGGGACACAA No data
Right 900022066 1:192170-192192 TCCCTCAGCCCCATTCAAAGAGG No data
900022059_900022073 30 Left 900022059 1:192130-192152 CCCGTGGCACCGTGGGGACACAA No data
Right 900022073 1:192183-192205 TTCAAAGAGGCCTGGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900022059 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG (reversed) Intergenic
No off target data available for this crispr