ID: 900022772

View in Genome Browser
Species Human (GRCh38)
Location 1:196078-196100
Sequence ACTCCTGGAATTGCACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900022769_900022772 8 Left 900022769 1:196047-196069 CCTGTGGGGGTGGAGGACAGGAA No data
Right 900022772 1:196078-196100 ACTCCTGGAATTGCACAGTGAGG No data
900022761_900022772 25 Left 900022761 1:196030-196052 CCAAGAGGAAAGAGGTGCCTGTG No data
Right 900022772 1:196078-196100 ACTCCTGGAATTGCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900022772 Original CRISPR ACTCCTGGAATTGCACAGTG AGG Intergenic
No off target data available for this crispr