ID: 900023313

View in Genome Browser
Species Human (GRCh38)
Location 1:199946-199968
Sequence AGGGCGCAGCGGAGGGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900023313_900023329 27 Left 900023313 1:199946-199968 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 900023329 1:199996-200018 GACCCGGAGCGCTGTCCTGTCGG No data
900023313_900023324 11 Left 900023313 1:199946-199968 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 900023324 1:199980-200002 GCTCCAGGACCCCGTCGACCCGG No data
900023313_900023330 28 Left 900023313 1:199946-199968 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 900023330 1:199997-200019 ACCCGGAGCGCTGTCCTGTCGGG No data
900023313_900023319 -4 Left 900023313 1:199946-199968 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 900023319 1:199965-199987 CCCTCCCCGAGCGCGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900023313 Original CRISPR AGGGCGCAGCGGAGGGCGAG CGG (reversed) Intergenic
No off target data available for this crispr