ID: 900023663

View in Genome Browser
Species Human (GRCh38)
Location 1:202308-202330
Sequence GTGTATATTCACAGGCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900023663_900023665 4 Left 900023663 1:202308-202330 CCACGATGCCTGTGAATATACAC No data
Right 900023665 1:202335-202357 ACCACATCATATACCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900023663 Original CRISPR GTGTATATTCACAGGCATCG TGG (reversed) Intergenic
No off target data available for this crispr