ID: 900023707

View in Genome Browser
Species Human (GRCh38)
Location 1:202596-202618
Sequence CCCAGCTGGCCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900023707_900023714 -8 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023714 1:202611-202633 CAGCTGGGCTGAGTGGGCCTGGG No data
900023707_900023720 20 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data
900023707_900023716 8 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023716 1:202627-202649 GCCTGGGAAATTAAGGCTGCAGG No data
900023707_900023718 9 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023718 1:202628-202650 CCTGGGAAATTAAGGCTGCAGGG No data
900023707_900023715 1 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023715 1:202620-202642 TGAGTGGGCCTGGGAAATTAAGG No data
900023707_900023719 13 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023719 1:202632-202654 GGAAATTAAGGCTGCAGGGTTGG No data
900023707_900023713 -9 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023713 1:202610-202632 CCAGCTGGGCTGAGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900023707 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr