ID: 900023720

View in Genome Browser
Species Human (GRCh38)
Location 1:202639-202661
Sequence AAGGCTGCAGGGTTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900023704_900023720 25 Left 900023704 1:202591-202613 CCCTGCCTGCCTTTGCTGGCCAG No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data
900023707_900023720 20 Left 900023707 1:202596-202618 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data
900023712_900023720 6 Left 900023712 1:202610-202632 CCAGCTGGGCTGAGTGGGCCTGG No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data
900023705_900023720 24 Left 900023705 1:202592-202614 CCTGCCTGCCTTTGCTGGCCAGC No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data
900023709_900023720 16 Left 900023709 1:202600-202622 CCTTTGCTGGCCAGCTGGGCTGA No data
Right 900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900023720 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG Intergenic
No off target data available for this crispr