ID: 900035283

View in Genome Browser
Species Human (GRCh38)
Location 1:402652-402674
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900035280_900035283 8 Left 900035280 1:402621-402643 CCGACTGCTGGGTGCGCGGCAGA No data
Right 900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG No data
900035278_900035283 14 Left 900035278 1:402615-402637 CCACAGCCGACTGCTGGGTGCGC No data
Right 900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG No data
900035277_900035283 15 Left 900035277 1:402614-402636 CCCACAGCCGACTGCTGGGTGCG No data
Right 900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900035283 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr