ID: 900037662

View in Genome Browser
Species Human (GRCh38)
Location 1:431010-431032
Sequence CTTTCCCCCATCGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900037658_900037662 20 Left 900037658 1:430967-430989 CCATATTGTGGAAAACACCTCAG No data
Right 900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG No data
900037657_900037662 29 Left 900037657 1:430958-430980 CCTTCACAGCCATATTGTGGAAA No data
Right 900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG No data
900037660_900037662 3 Left 900037660 1:430984-431006 CCTCAGCAGTATGTGCTGGAATT No data
Right 900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900037662 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG Intergenic
No off target data available for this crispr