ID: 900053960

View in Genome Browser
Species Human (GRCh38)
Location 1:615439-615461
Sequence TTCCTGAAGGAGAAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053960_900053964 24 Left 900053960 1:615439-615461 CCTGCAGCTTTCTCCTTCAGGAA No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data
900053960_900053963 23 Left 900053960 1:615439-615461 CCTGCAGCTTTCTCCTTCAGGAA No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053960 Original CRISPR TTCCTGAAGGAGAAAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr