ID: 900053961

View in Genome Browser
Species Human (GRCh38)
Location 1:615452-615474
Sequence AGGCTGCGCTTTGTTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053961_900053963 10 Left 900053961 1:615452-615474 CCTTCAGGAACAAAGCGCAGCCT No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data
900053961_900053964 11 Left 900053961 1:615452-615474 CCTTCAGGAACAAAGCGCAGCCT No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053961 Original CRISPR AGGCTGCGCTTTGTTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr