ID: 900053962

View in Genome Browser
Species Human (GRCh38)
Location 1:615472-615494
Sequence GTTGATTGCTAGCTGCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053962_900053973 30 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053973 1:615525-615547 TCTGCAGTGCACCCTGGTAGGGG No data
900053962_900053972 29 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053972 1:615524-615546 TTCTGCAGTGCACCCTGGTAGGG No data
900053962_900053963 -10 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data
900053962_900053969 24 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053969 1:615519-615541 AGACCTTCTGCAGTGCACCCTGG No data
900053962_900053964 -9 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data
900053962_900053971 28 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053971 1:615523-615545 CTTCTGCAGTGCACCCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053962 Original CRISPR GTTGATTGCTAGCTGCTAAG AGG (reversed) Intergenic
No off target data available for this crispr