ID: 900053963

View in Genome Browser
Species Human (GRCh38)
Location 1:615485-615507
Sequence AGCAATCAACTCCTGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053960_900053963 23 Left 900053960 1:615439-615461 CCTGCAGCTTTCTCCTTCAGGAA No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data
900053961_900053963 10 Left 900053961 1:615452-615474 CCTTCAGGAACAAAGCGCAGCCT No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data
900053962_900053963 -10 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053963 1:615485-615507 AGCAATCAACTCCTGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053963 Original CRISPR AGCAATCAACTCCTGTGCTC AGG Intergenic
No off target data available for this crispr