ID: 900053964

View in Genome Browser
Species Human (GRCh38)
Location 1:615486-615508
Sequence GCAATCAACTCCTGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053960_900053964 24 Left 900053960 1:615439-615461 CCTGCAGCTTTCTCCTTCAGGAA No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data
900053961_900053964 11 Left 900053961 1:615452-615474 CCTTCAGGAACAAAGCGCAGCCT No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data
900053962_900053964 -9 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053964 1:615486-615508 GCAATCAACTCCTGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053964 Original CRISPR GCAATCAACTCCTGTGCTCA GGG Intergenic
No off target data available for this crispr