ID: 900053966

View in Genome Browser
Species Human (GRCh38)
Location 1:615509-615531
Sequence CTGCAGAAGGTCTGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053966_900053977 13 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data
900053966_900053973 -7 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053973 1:615525-615547 TCTGCAGTGCACCCTGGTAGGGG No data
900053966_900053972 -8 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053972 1:615524-615546 TTCTGCAGTGCACCCTGGTAGGG No data
900053966_900053971 -9 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053971 1:615523-615545 CTTCTGCAGTGCACCCTGGTAGG No data
900053966_900053974 -6 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053974 1:615526-615548 CTGCAGTGCACCCTGGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053966 Original CRISPR CTGCAGAAGGTCTGGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr