ID: 900053969

View in Genome Browser
Species Human (GRCh38)
Location 1:615519-615541
Sequence AGACCTTCTGCAGTGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053962_900053969 24 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053969 1:615519-615541 AGACCTTCTGCAGTGCACCCTGG No data
900053965_900053969 0 Left 900053965 1:615496-615518 CCTGTGCTCAGGGCCTTCCAGCC No data
Right 900053969 1:615519-615541 AGACCTTCTGCAGTGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053969 Original CRISPR AGACCTTCTGCAGTGCACCC TGG Intergenic
No off target data available for this crispr