ID: 900053973

View in Genome Browser
Species Human (GRCh38)
Location 1:615525-615547
Sequence TCTGCAGTGCACCCTGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053965_900053973 6 Left 900053965 1:615496-615518 CCTGTGCTCAGGGCCTTCCAGCC No data
Right 900053973 1:615525-615547 TCTGCAGTGCACCCTGGTAGGGG No data
900053962_900053973 30 Left 900053962 1:615472-615494 CCTCTTAGCAGCTAGCAATCAAC No data
Right 900053973 1:615525-615547 TCTGCAGTGCACCCTGGTAGGGG No data
900053966_900053973 -7 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053973 1:615525-615547 TCTGCAGTGCACCCTGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053973 Original CRISPR TCTGCAGTGCACCCTGGTAG GGG Intergenic
No off target data available for this crispr