ID: 900053974

View in Genome Browser
Species Human (GRCh38)
Location 1:615526-615548
Sequence CTGCAGTGCACCCTGGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053967_900053974 -10 Left 900053967 1:615513-615535 CCAGCCAGACCTTCTGCAGTGCA No data
Right 900053974 1:615526-615548 CTGCAGTGCACCCTGGTAGGGGG No data
900053965_900053974 7 Left 900053965 1:615496-615518 CCTGTGCTCAGGGCCTTCCAGCC No data
Right 900053974 1:615526-615548 CTGCAGTGCACCCTGGTAGGGGG No data
900053966_900053974 -6 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053974 1:615526-615548 CTGCAGTGCACCCTGGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053974 Original CRISPR CTGCAGTGCACCCTGGTAGG GGG Intergenic
No off target data available for this crispr