ID: 900053977

View in Genome Browser
Species Human (GRCh38)
Location 1:615545-615567
Sequence GGGGTAAATTATCCTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900053968_900053977 5 Left 900053968 1:615517-615539 CCAGACCTTCTGCAGTGCACCCT No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data
900053965_900053977 26 Left 900053965 1:615496-615518 CCTGTGCTCAGGGCCTTCCAGCC No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data
900053967_900053977 9 Left 900053967 1:615513-615535 CCAGCCAGACCTTCTGCAGTGCA No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data
900053970_900053977 0 Left 900053970 1:615522-615544 CCTTCTGCAGTGCACCCTGGTAG No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data
900053966_900053977 13 Left 900053966 1:615509-615531 CCTTCCAGCCAGACCTTCTGCAG No data
Right 900053977 1:615545-615567 GGGGTAAATTATCCTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900053977 Original CRISPR GGGGTAAATTATCCTGAGCT TGG Intergenic
No off target data available for this crispr