ID: 900056904

View in Genome Browser
Species Human (GRCh38)
Location 1:638405-638427
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900056899_900056904 14 Left 900056899 1:638368-638390 CCACAGCCGACTGCTGGGTGCGC No data
Right 900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG No data
900056898_900056904 15 Left 900056898 1:638367-638389 CCCACAGCCGACTGCTGGGTGCG No data
Right 900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG No data
900056901_900056904 8 Left 900056901 1:638374-638396 CCGACTGCTGGGTGCGCGGCAGA No data
Right 900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900056904 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr