ID: 900058433

View in Genome Browser
Species Human (GRCh38)
Location 1:654224-654246
Sequence ATACAGAAAAGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900058428_900058433 11 Left 900058428 1:654190-654212 CCCATGGTAACCACTAAGTTAAT No data
Right 900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG No data
900058429_900058433 10 Left 900058429 1:654191-654213 CCATGGTAACCACTAAGTTAATA No data
Right 900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG No data
900058430_900058433 1 Left 900058430 1:654200-654222 CCACTAAGTTAATATCTTTTGAA No data
Right 900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG No data
900058427_900058433 12 Left 900058427 1:654189-654211 CCCCATGGTAACCACTAAGTTAA No data
Right 900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900058433 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG Intergenic
No off target data available for this crispr