ID: 900059292

View in Genome Browser
Species Human (GRCh38)
Location 1:666753-666775
Sequence CTTTCCCCCATCGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900059287_900059292 29 Left 900059287 1:666701-666723 CCTTCACAGCCATATTGTGGGAA No data
Right 900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG No data
900059290_900059292 3 Left 900059290 1:666727-666749 CCTCAGCAGTATGTGCTGGAATT No data
Right 900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG No data
900059288_900059292 20 Left 900059288 1:666710-666732 CCATATTGTGGGAAACACCTCAG No data
Right 900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900059292 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG Intergenic
No off target data available for this crispr